SGN Marker solcap_snp_sl_100104

SGN-M17688

Synonyms  
CL009003-0789
CL009003-0789_SL10015_808
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54019)
Chromosome
8
Position
22.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATGGTATCTGATAATTTCTTAATAATGACTTCTANATGGACTATCAAAGCATACATAATGTGTTTGCACAGTAATCTTTCTCAGTCTGCTGACTGATTC
  
3' flanking region
ACTTGATATACATATTCCTTGGNGTCGTTCTTTATATCAATTGTGCTTCTATTCTTAGGTTCAACTACATNCATTATGACAAAAGCCATGGAGCTATTTA
SNP nucleotide
AT
SNPdb format
CATGGTATCTGATAATTTCTTAATAATGACTTCTANATGGACTATCAAAGCATACATAATGTGTTTGCACAGTAATCTTTCTCAGTCTGCTGACTGATTC[A/T]
ACTTGATATACATATTCCTTGGNGTCGTTCTTTATATCAATTGTGCTTCTATTCTTAGGTTCAACTACATNCATTATGACAAAAGCCATGGAGCTATTTA
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43522)
Chromosome
8
Position
3.40 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43114)
Chromosome
8
Position
20.60 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
AGTAATCTTTCTCAGTCTGCTGACTGATTC
ASPE primers (5'-3')
CAGTCTGCTGACTGATTCA
CAGTCTGCTGACTGATTCT
3' flanking region
ACTTGATATACATATTCCTTGGCGTCGTTC
SNP nucleotide
AT
SNPdb format
AGTAATCTTTCTCAGTCTGCTGACTGATTC[A/T]
ACTTGATATACATATTCCTTGGCGTCGTTC
  
Genomic location of solcap_snp_sl_100104  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17688 marker 17688
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)