SGN Marker solcap_snp_sl_100109

SGN-M17693

Synonyms  
CL009012-0319
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54024)
Chromosome
7
Position
63.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAAGAAGATCCAGTCAACAAAAACTGAACTAATANTGTNTTCATAACATAAAATGTGGAACTATTTAAGCTAGCCCCTAGTCCTACTAGTGAAATCTCCT
  
3' flanking region
GAACAGAATCTGTTTTCTTGGAATTGCTAGNGTCAAGAAAATTTAGAGCTCTTCATACTTGNGNGTGTGCAGCTCATTTGATTATTCNTTAGGTACTCCT
SNP nucleotide
TC
SNPdb format
TAAGAAGATCCAGTCAACAAAAACTGAACTAATANTGTNTTCATAACATAAAATGTGGAACTATTTAAGCTAGCCCCTAGTCCTACTAGTGAAATCTCCT[T/C]
GAACAGAATCTGTTTTCTTGGAATTGCTAGNGTCAAGAAAATTTAGAGCTCTTCATACTTGNGNGTGTGCAGCTCATTTGATTATTCNTTAGGTACTCCT
  
Genomic location of solcap_snp_sl_100109  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17693 marker 17693
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)