SGN Marker solcap_snp_sl_100111

SGN-M17695

Synonyms  
CL009018-1241
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54026)
Chromosome
2
Position
34.88 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATACAGNGTAATCCCATGGGTGGGGGACGACGGTACTCCTACCTCCTAGGGGTAGAACAATTGTTCGCAAAAGACCCTAGGCTCAAGTAAAGCATACCA
  
3' flanking region
AGCAAAGGATAGAGTTACCAGAATGAGAAAAGCTAATAATTTCCTATTTGCAAACAAACTGATAATTATCCAGAATTTTTGAGAAAGAGATAAAGGATTA
SNP nucleotide
AG
SNPdb format
TATACAGNGTAATCCCATGGGTGGGGGACGACGGTACTCCTACCTCCTAGGGGTAGAACAATTGTTCGCAAAAGACCCTAGGCTCAAGTAAAGCATACCA[A/G]
AGCAAAGGATAGAGTTACCAGAATGAGAAAAGCTAATAATTTCCTATTTGCAAACAAACTGATAATTATCCAGAATTTTTGAGAAAGAGATAAAGGATTA
  
Genomic location of solcap_snp_sl_100111  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17695 marker 17695
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)