SGN Marker solcap_snp_sl_100157

SGN-M17737

Synonyms  
CL009263-0356
CL009263-0356_SL20159_1147
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54068)
Chromosome
9
Position
3.79 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTCATATCACTTTTCTGCGTTTGANAATGTGACTTNAGATTTTCANAATTTCNGTTTCAGGGTGATGCAGGTTATCAAGATGTAATTGAGTGCTCAAGT
  
3' flanking region
CACTAGCTAAGGTTTGCAGTTTGTCCATTTTGGTTTAGACTTTAGATATTTGGTTTCTGATATTAATTTTCAATTNTAATAGTTACTTCAACTGAAGCAA
SNP nucleotide
TG
SNPdb format
TGTCATATCACTTTTCTGCGTTTGANAATGTGACTTNAGATTTTCANAATTTCNGTTTCAGGGTGATGCAGGTTATCAAGATGTAATTGAGTGCTCAAGT[T/G]
CACTAGCTAAGGTTTGCAGTTTGTCCATTTTGGTTTAGACTTTAGATATTTGGTTTCTGATATTAATTTTCAATTNTAATAGTTACTTCAACTGAAGCAA
  

Map: Sun1642 x LA1589   
Map version
85 (location: 43772)
Chromosome
9
Position
16.80 cM
Confidence
uncalculated
Protocol
SNP


Sun1642 x LA1589

Assay data  
5' flanking region
GGTTATCAAGATGTAATTGAGTGCTCAAGT
ASPE primers (5'-3')
TGCAAACCTTAGCTAGTGC
TGCAAACCTTAGCTAGTGA
3' flanking region
CACTAGCTAAGGTTTGCAGTTTGTCCATTT
SNP nucleotide
GT
SNPdb format
GGTTATCAAGATGTAATTGAGTGCTCAAGT[G/T]
CACTAGCTAAGGTTTGCAGTTTGTCCATTT
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43230)
Chromosome
9
Position
32.10 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
GGTTATCAAGATGTAATTGAGTGCTCAAGT
ASPE primers (5'-3')
TGCAAACCTTAGCTAGTGC
TGCAAACCTTAGCTAGTGA
3' flanking region
CACTAGCTAAGGTTTGCAGTTTGTCCATTT
SNP nucleotide
GT
SNPdb format
GGTTATCAAGATGTAATTGAGTGCTCAAGT[G/T]
CACTAGCTAAGGTTTGCAGTTTGTCCATTT
  
Genomic location of solcap_snp_sl_100157  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17737 marker 17737
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)