SGN Marker solcap_snp_sl_100164

SGN-M17742

Synonyms  
CL009286-0792
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54073)
Chromosome
1
Position
2.44 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTTTATTTGTGTGATTATTTTATGGTTTTCAATTAGGTCTCATGATGCCAATGAGTTATGGATATTACTGANGCTTTGTGATTAGGTAAAGGTGATCAC
  
3' flanking region
CTTTGTCAATCAAGAGACAAGGATGGCGAAGATGGTAATAAAAGCAACCATTTCTTTTTTCGAGTGCTTTCTTCCAGTTTAGATTATAAAAGTTCCTCTT
SNP nucleotide
AT
SNPdb format
CCTTTATTTGTGTGATTATTTTATGGTTTTCAATTAGGTCTCATGATGCCAATGAGTTATGGATATTACTGANGCTTTGTGATTAGGTAAAGGTGATCAC[A/T]
CTTTGTCAATCAAGAGACAAGGATGGCGAAGATGGTAATAAAAGCAACCATTTCTTTTTTCGAGTGCTTTCTTCCAGTTTAGATTATAAAAGTTCCTCTT
  
Genomic location of solcap_snp_sl_100164  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17742 marker 17742
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)