Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_100179

SGN-M17754

Synonyms  
CL015090-0120
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54085)
Chromosome
7
Position
54.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGGCAATGGGCGGTCAAGCTCCGAAGACAGTGATCACCGATCATGACCTGGTATTGAAGTCAGTCATTTCAGAGGCTTTGCC
  
3' flanking region
CTATCCCTCCATTATTTCTGTTTNTGGCATNTCCTGGGAAAGGTGTCTGATACACTGAATCATGTCATCAAACAGAATGAAAAGTTTATGCCTAAGTTCG
SNP nucleotide
AG
SNPdb format
AGGCAATGGGCGGTCAAGCTCCGAAGACAGTGATCACCGATCATGACCTGGTATTGAAGTCAGTCATTTCAGAGGCTTTGCC[A/G]
CTATCCCTCCATTATTTCTGTTTNTGGCATNTCCTGGGAAAGGTGTCTGATACACTGAATCATGTCATCAAACAGAATGAAAAGTTTATGCCTAAGTTCG
  
Genomic location of solcap_snp_sl_100179  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17754 marker 17754
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)