SGN Marker solcap_snp_sl_100181

SGN-M17756

Synonyms  
CL015101-0449
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54087)
Chromosome
9
Position
44.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTAGATTCTTTGTTTATATTTNTTANGCTGTTGGAGCAAATCTAGTAGTATAGACGTGGGCTCATAAAACTGTTAGCCAAGACACAGATCTATGTAAAAT
  
3' flanking region
CATTGGAATTGCTGAAAAT
SNP nucleotide
AT
SNPdb format
GTAGATTCTTTGTTTATATTTNTTANGCTGTTGGAGCAAATCTAGTAGTATAGACGTGGGCTCATAAAACTGTTAGCCAAGACACAGATCTATGTAAAAT[A/T]
CATTGGAATTGCTGAAAAT
  
Genomic location of solcap_snp_sl_100181  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17756 marker 17756
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)