SGN Marker solcap_snp_sl_100198

SGN-M17770

Synonyms  
CL015198-0299
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54101)
Chromosome
7
Position
58.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTACATTAGAGTGGTTCNATGCTGTGCAATAGCCAATGCCAATGCTTGCAGCTTAACTAGGCNAGTATGGCTGCTTGTTTAATTTTTTCTTAAGTTCTGA
  
3' flanking region
GCTAAATCTTCAAGCTTTGCCCACTTTTCTCAAAAAAAATATTAATCTGTAAAAGCTCTTTCCNCAAGTTTTCTCAGTTTGCGTTCACTNTAAACAAAGA
SNP nucleotide
AG
SNPdb format
CTACATTAGAGTGGTTCNATGCTGTGCAATAGCCAATGCCAATGCTTGCAGCTTAACTAGGCNAGTATGGCTGCTTGTTTAATTTTTTCTTAAGTTCTGA[A/G]
GCTAAATCTTCAAGCTTTGCCCACTTTTCTCAAAAAAAATATTAATCTGTAAAAGCTCTTTCCNCAAGTTTTCTCAGTTTGCGTTCACTNTAAACAAAGA
  
Genomic location of solcap_snp_sl_100198  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17770 marker 17770
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)