SGN Marker solcap_snp_sl_100204

SGN-M17776

Synonyms  
CL015239-0564
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54107)
Chromosome
7
Position
62.30 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGTATATCTTTTATTCTGCACTCGCNTGTAGAGAATCAGTAGTTATTTGTGTGCCTTGTNATGAGGGAGCACGTTTAGGTCTTATNGTTNTGTTTGTTT
  
3' flanking region
ACTGTCTGCAACCTCACAGTAGCTTATCCTGTGCCTCTCTACACTATTGTTTGTGATCACGTGACTTGTTGCTAGTATGTTNTAGCACCTGAAAGTGGTG
SNP nucleotide
CG
SNPdb format
GTGTATATCTTTTATTCTGCACTCGCNTGTAGAGAATCAGTAGTTATTTGTGTGCCTTGTNATGAGGGAGCACGTTTAGGTCTTATNGTTNTGTTTGTTT[C/G]
ACTGTCTGCAACCTCACAGTAGCTTATCCTGTGCCTCTCTACACTATTGTTTGTGATCACGTGACTTGTTGCTAGTATGTTNTAGCACCTGAAAGTGGTG
  
Genomic location of solcap_snp_sl_100204  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17776 marker 17776
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)