SGN Marker T1123

SGN-M1778
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.03
Tomato EST read: TFBBC29TH
Arabidopsis best BAC match: AC006954.7
Arabidopsis position: 2.1390000
Arabidopsis identities: 0.965
Best GenBank protein hit: AAD23894.1
Evalue: 8.5e-32
Identities: 0.775
Description: putative RSZp22 splicing factor [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49393)
Chromosome
8
Position
1.04 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47328)
Chromosome
8
Position
2.78 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39510)
Chromosome
8
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1123 was used as an overgo probe on plate 1 [well C6]

Plausible BAC Matches:   P260L08,   P268D24,   P260E11,   P252I21,   P216M19

 Overgo Sequences

A sequence
ATGACCGTAGAGATGCACAAGACG
B sequence
TCCAGATCCCTGATTGCGTCTTGT
AB sequence
ATGACCGTAGAGATGCACAAGACGCAATCA
Marker sequence
GGTTTCAGGTTATTATTCCGAGATGTCAAGAGTGTACGTTGGAAATCTTG
ATCCTAGGGTCACTGAAAGAGAACTAGAAGATGAATTCCGTGTCTTTGGA
GTTATAAGAAGTGTTTGGGTTGCAAGACGCCCACCTGGTTATGCCTTTAT
TGACTTTGATGACCGTAGAGATGCACAAGACGCAATCAGGGATCTGGATG
GTCAGAATGGATGGAGAGTGGAGCTCTCACATAATTCTAGAGGAGAAAGG
GGTGGGGGCCGTGGAGGGGGTCGTGGTCGTTCTGGAGGTTCTGATTTGAA
GTGCTATGAGTGTGGTGAGTCTGGTCATTTTGCTCGTGAATGCAGAGTGC
GAGGAGGTCCACGTCCTGTTAAACGTACAAGTCGTAGCCCCCCTAGATAT
CGGAGGAGTCCAAGTTATGGTCACAGGAGTTATAGT
Genomic location of T1123  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1778 marker 1778
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)