SGN Marker solcap_snp_sl_100221

SGN-M17792

Synonyms  
CL015333-0342
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54123)
Chromosome
7
Position
64.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTAAGTTGGAGGTACTTGACACAAGTGGGTGCAGAAGCATTGGAAACCCCTGTCTCTTTGTCATATCAAGAGTTACTACACTCACAAAACTAAACTTAGC
  
3' flanking region
GAAGCTGATATCACCGACAAGGGTCTTGCTTTGCTTGGTATGGGAAACTTGGGCATTACACAGTTGTGCATCAGAGGCTGTAAGAGAGTAACTGATAAGG
SNP nucleotide
AC
SNPdb format
GTAAGTTGGAGGTACTTGACACAAGTGGGTGCAGAAGCATTGGAAACCCCTGTCTCTTTGTCATATCAAGAGTTACTACACTCACAAAACTAAACTTAGC[A/C]
GAAGCTGATATCACCGACAAGGGTCTTGCTTTGCTTGGTATGGGAAACTTGGGCATTACACAGTTGTGCATCAGAGGCTGTAAGAGAGTAACTGATAAGG
  
Genomic location of solcap_snp_sl_100221  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17792 marker 17792
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)