SGN Marker TG546

SGN-M178

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AACAAAACATAATTGAGGGTAGTAACTCGTTGAGCTCCCCACATTGGTCATTTAGGGATGAGAAGATCTGTTTATATTGTCTTGGACAAT
CCTCACCTCATGAGCTAGCTTTTGGAGTTATGTTAGACCCAAAATCCATTTTTTTCGGCATGCCAGGGGTGTTGACTGTTGAGTTCCCAC
ATCAGTCATTTAGGGTTGAAAAACCTCTTTTCCTTTTTATAATAGGTATGGAGTCTAGATGTTCAAAGAAAAAGAGGTATGGAGTCTCTT
AATATGGTCTTGGAGAATTCTCACCTTATGAGCTAGTTTTTGGGGTTGAATTAGACCTAAGGTCTATTTTTGTATCATAACTTATACTAG
TACCCAGGTATTTGATCCATTCTATAGGCAGTGATCTTTCTGTTTGCCAAACCATCAATTATCTTCCAACTAATAGTCCTCTGATTCTGA
ACTTCAGGTATCTCATGAAAATTTTTC
Reverse sequence
CAGTGACTAAAGAATAAACTTCACATGTTTTAAGATTCGGACTTGACTACAGTCTACAAGATTGCACATAATATGAGACTTTTTCGTCCA
CCAGAATATTTTACGAAAATCATAGTTCTTTGTTATTCCTTATTCCTTGGGAAATAAACGGTTTCATAATCAGGACAAGACTTCTGCTTG
AAACACATGAATTGAAAGAAGCAGCAGAAATAATAATTTTTCTCATCCTCTCGACTGAATCAACCCTTCCATATTGTCAATGGTTTTACC
AATAGGTAATATTTTTTTAAGTCTGAATTTTCACACGTTGAATCAGGAGCATTAATATCTTTATACCAGTGAATCAAATTTCTTACATAT
CTAACAGAGATGCAAACTTCCTCGCCAACTTTATACACCATGGGTTCTTCCAAAAGAAATTTAGCTTCTGGGATGTAAAACTGGTTTCAT
AACATTGAAATAATTCACTTCGATGATATATTTAACTGTTAACATTTTCTTATTCAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1561672.1e-0634 (7.1% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53565)
Chromosome
11
Position
98.18 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43878)
Chromosome
11
Position
82.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43617)
Chromosome
11
Position
66.90 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43340)
Chromosome
11
Position
70.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40080)
Chromosome
11
Position
77.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8453)
Chromosome
11
Position
63.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8457)
Chromosome
11
Position
86.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG546 was used as an overgo probe on plate 10 [well A10]

Plausible BAC Matches:   P068O18,   P142C16,   P068N14,   P095P19,   P054H11

 Overgo Sequences

A sequence
GTCTTGGACAATCCTCACCTCATG
B sequence
ACTCCAAAAGCTAGCTCATGAGGT
AB sequence
GTCTTGGACAATCCTCACCTCATGAGCTAG
Marker sequence
AACAAAACATAATTGAGGGTAGTAACTCGTTGAGCTCCCCACATTGGTCA
TTTAGGGATGAGAAGATCTGTTTATATTGTCTTGGACAATCCTCACCTCA
TGAGCTAGCTTTTGGAGTTATGTTAGACCCAAAATCCATTTTTTTCGGCA
TGCCAGGGGTGTTGACTGTTGAGTTCCCACATCAGTCATTTAGGGTTGAA
AAACCTCTTTTCCTTTTTATAATAGGTATGGAGTCTAGATGTTCAAAGAA
AAAGAGGTATGGAGTCTCTTAATATGGTCTTGGAGAATTCTCACCTTATG
AGCTAGTTTTTGGGGTTGAATTAGACCTAAGGTCTATTTTTGTATCATAA
CTTATACTAGTACCCAGGTATTTGATCCATTCTATAGGCAGTGATCTTTC
TGTTTGCCAAACCATCAATTATCTTCCAACTAATAGTCCTCTGATTCTGA
ACTTCAGGTATCTCATGAAAATTTTTC
Genomic location of TG546  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D178 marker 178
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)