SGN Marker solcap_snp_sl_100235

SGN-M17806

Synonyms  
CL015430-0435
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54137)
Chromosome
2
Position
33.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCACATTTTGCTACTCTATCTCCAAAGAGCTCAACAAGAAGAACGCCCCGTTATCTCTGCCATATTGTTACAGCTTGATCTTTTGGTAAGTCTGTTTCC
  
3' flanking region
TTATAGTCCTATCCGATTCAATGAATAATTCNGAAGGAATCCTCATTTAGCTGCAGTCATGCTGCAGGGAGATCCGAACGAGTGCAGTGTGTATAGAGAA
SNP nucleotide
TG
SNPdb format
TGCACATTTTGCTACTCTATCTCCAAAGAGCTCAACAAGAAGAACGCCCCGTTATCTCTGCCATATTGTTACAGCTTGATCTTTTGGTAAGTCTGTTTCC[T/G]
TTATAGTCCTATCCGATTCAATGAATAATTCNGAAGGAATCCTCATTTAGCTGCAGTCATGCTGCAGGGAGATCCGAACGAGTGCAGTGTGTATAGAGAA
  
Genomic location of solcap_snp_sl_100235  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17806 marker 17806
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)