SGN Marker T1128

SGN-M1781
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBD02TH
Arabidopsis best BAC match: AB010076.1
Arabidopsis position: 5.2840000
Arabidopsis identities: 0.776
Best GenBank protein hit: AAG15240.1
Evalue:
Identities: 0.000
Description: ENOD2 [Styphnolobium japonicum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39512)
Chromosome
1
Position
145.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1128 was used as an overgo probe on plate 9 [well A4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGCCATTGCTGTCTGGTTTTCTC
B sequence
ATGGAAGCTGCAGATGGAGAAAAC
AB sequence
TTGCCATTGCTGTCTGGTTTTCTCCATCTG
Marker sequence
GAGACGATCATCTCGTTGTTGTTATCTCTTTGCCATATTTATTCTTGCCA
TTGCTGTCTGGTTTTCTCCATCTGCAGCTTCCATCGCTGGCAAAGATATT
AATCCTCCATATCCTAAAGCTATTTCTGACTTGAAGGAGTCAATTGTGAA
GGGTTTAGGTTTTCAAGCGGAGGATTTCAAGATATCTGGGTTTGATTTGA
AAGATGCTCTTGTGGGTAGGTCGGTGTCTTATGAGTTTGATGTGGAAGTT
GATAATAAAGTAATTCCCTTAAAGCTTTTGGAGGATGTGAATAAATGGGA
ATTTGTAGATTTGCCTATTTTTCGGGTAGAGAAAGGTGAAGAAAATGGGT
TGGTTGAAAGGCAGACATTGGAGAATCATGTGCCTGTTTTGGCTCCATTT
ACTTTGGCAGGG
Genomic location of T1128  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1781 marker 1781
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)