SGN Marker solcap_snp_sl_100287

SGN-M17853

Synonyms  
CL015678-0355
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54184)
Chromosome
5
Position
0.11 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGATGTTGTGGGATTAAGTGGTGGTGATAGAAAAAAAGTTGCAGTGGGTGAGGGTAAAGGGNGTTTGNCTGTGGAGAAGAATGCTGTGTTGTTTAAAAGT
  
3' flanking region
ATGGAGAATCATTGATTAGACGCCACAGGGATTTTTATGGGGATTGTGATGTATATGATGGTGAATGGGTTAGAGATGACACGAAGCCGTATTATCCTCC
SNP nucleotide
AG
SNPdb format
GGATGTTGTGGGATTAAGTGGTGGTGATAGAAAAAAAGTTGCAGTGGGTGAGGGTAAAGGGNGTTTGNCTGTGGAGAAGAATGCTGTGTTGTTTAAAAGT[A/G]
ATGGAGAATCATTGATTAGACGCCACAGGGATTTTTATGGGGATTGTGATGTATATGATGGTGAATGGGTTAGAGATGACACGAAGCCGTATTATCCTCC
  
Genomic location of solcap_snp_sl_100287  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17853 marker 17853
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)