SGN Marker solcap_snp_sl_100288

SGN-M17854

Synonyms  
CL015682-0115
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54185)
Chromosome
6
Position
22.27 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAGAATGGTNGGCTATTTTCTGCGTAGA
  
3' flanking region
AGTGTGAAGCTTTGGAGGATTGGAGGTCCGATAGCGTTTAATATTATCTGTCAATATGGTGTGAATTCACTTACTAATATATTCGTTGGGCATCTTGGAG
SNP nucleotide
AG
SNPdb format
AGAGAATGGTNGGCTATTTTCTGCGTAGA[A/G]
AGTGTGAAGCTTTGGAGGATTGGAGGTCCGATAGCGTTTAATATTATCTGTCAATATGGTGTGAATTCACTTACTAATATATTCGTTGGGCATCTTGGAG
  
Genomic location of solcap_snp_sl_100288  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17854 marker 17854
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)