SGN Marker solcap_snp_sl_100291

SGN-M17857

Synonyms  
CL015690-0139
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54188)
Chromosome
9
Position
41.85 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTCGTTGTAAAGCTTTTGANCTTTGCTGATTGCAGACCTTTTCCCTTATCAGTTGGATTCGTTGCTCAATATGTCCTGAAGCCAGCTCTTGGTTTGTTG
  
3' flanking region
TAGCACAGGCATTTGGAATGCCTACAACGTTCTACGCTGGTTTTGTCCTTNTGTCTTGTGTTGCAGGGGCTCAATTATCAAGTTANGCCAGCTTCTTGAG
SNP nucleotide
TG
SNPdb format
TTTCGTTGTAAAGCTTTTGANCTTTGCTGATTGCAGACCTTTTCCCTTATCAGTTGGATTCGTTGCTCAATATGTCCTGAAGCCAGCTCTTGGTTTGTTG[T/G]
TAGCACAGGCATTTGGAATGCCTACAACGTTCTACGCTGGTTTTGTCCTTNTGTCTTGTGTTGCAGGGGCTCAATTATCAAGTTANGCCAGCTTCTTGAG
  
Genomic location of solcap_snp_sl_100291  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17857 marker 17857
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)