SGN Marker solcap_snp_sl_100292

SGN-M17858

Synonyms  
CL015702-0287
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54189)
Chromosome
2
Position
40.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAAAGTTCCATTTCATGGTGGTCTTCTTTGTCTCGTAAGGCTAACTGAATGCTTGCAGCCATGACAGATTTCAAATCCTTTGAGATGATTCGTGTTTTT
  
3' flanking region
CTTTGTAAAGTTTAGTTTCTTTACTCCCCCTCACTGAACCGCCCTTTTTCGTGAAACTACACANANGCTTCCTCTTTTCTTATTCTTATTANTCTCTCTA
SNP nucleotide
AG
SNPdb format
AGAAAGTTCCATTTCATGGTGGTCTTCTTTGTCTCGTAAGGCTAACTGAATGCTTGCAGCCATGACAGATTTCAAATCCTTTGAGATGATTCGTGTTTTT[A/G]
CTTTGTAAAGTTTAGTTTCTTTACTCCCCCTCACTGAACCGCCCTTTTTCGTGAAACTACACANANGCTTCCTCTTTTCTTATTCTTATTANTCTCTCTA
  
Genomic location of solcap_snp_sl_100292  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17858 marker 17858
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)