SGN Marker solcap_snp_sl_100303

SGN-M17869

Synonyms  
CL015763-0127
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54200)
Chromosome
6
Position
33.31 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTTATAGAGAAAGAACGATCTCCAGATTTTCTATCTATCCCATTTCAGAGTGCTACGATTGATAAAAAACATAGTCCTCCTCTTCCACCGCTTCAGTCN
  
3' flanking region
ATTTGGAAGTTGAAAATTTGGAAGATTCCAGCTCAACGCCTGAGATACCTCAGCAGGTGGAGGAACGTGAACTTGGCATTNTGTTCTCTGCAAATGCAGC
SNP nucleotide
TC
SNPdb format
TGTTATAGAGAAAGAACGATCTCCAGATTTTCTATCTATCCCATTTCAGAGTGCTACGATTGATAAAAAACATAGTCCTCCTCTTCCACCGCTTCAGTCN[T/C]
ATTTGGAAGTTGAAAATTTGGAAGATTCCAGCTCAACGCCTGAGATACCTCAGCAGGTGGAGGAACGTGAACTTGGCATTNTGTTCTCTGCAAATGCAGC
  
Genomic location of solcap_snp_sl_100303  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17869 marker 17869
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)