SGN Marker solcap_snp_sl_100307

SGN-M17872

Synonyms  
CL015795-0204
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54203)
Chromosome
8
Position
0.03 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGNCGAAATTGGAAAAGGGATGCCCGAAAGGCCCATGTTGCCAGGCAGAATGAAGTTAGTACTAATAATACGGTTTCTCCAGATTTAGCTTCAATTGGTG
  
3' flanking region
AGGTCAAGCAACATTACTTACCCACGTTGAACAGTCAGATGTCGCGATGAGTGATGTNATTTCTTCACCTGTGACTGCATNGGAAAATATCGGAACACCC
SNP nucleotide
AG
SNPdb format
GGNCGAAATTGGAAAAGGGATGCCCGAAAGGCCCATGTTGCCAGGCAGAATGAAGTTAGTACTAATAATACGGTTTCTCCAGATTTAGCTTCAATTGGTG[A/G]
AGGTCAAGCAACATTACTTACCCACGTTGAACAGTCAGATGTCGCGATGAGTGATGTNATTTCTTCACCTGTGACTGCATNGGAAAATATCGGAACACCC
  
Genomic location of solcap_snp_sl_100307  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17872 marker 17872
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)