SGN Marker T1140

SGN-M1790
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TFBBE94TH
Arabidopsis best BAC match: AL132962.1
Arabidopsis position: 3.2500000
Arabidopsis identities: 0.852
Best GenBank protein hit: CAA32197.1
Evalue: 1.1e-90
Identities: 1.000
Description: chlorophyll a/b-binding protein [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39517)
Chromosome
10
Position
2.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1140 was used as an overgo probe on plate 1 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTACTACACCTACAGCACGAAGTG
B sequence
ACGCACACTGTAGTTGCACTTCGT
AB sequence
GTACTACACCTACAGCACGAAGTGCAACTA
Marker sequence
GTGAAGAATTTGCCGACATGGCCTCAGCTTGTGCTTCATCCACCATTGCT
GCTGTTGCTTTTTCTTCTCCAAGTTCGAGGAGAAATGGATCAATTGTAGG
AACAACAAAAGCTTCATTCCTTGGAGGAAGAAGATTGAGAGTAAGCAAAT
ACAGTACTACACCTACAGCACGAAGTGCAACTACAGTGTGCGTTGCTGCA
GACCCTGACAGACCCCTCTGGTTCCCTGGCAGCACCCCACCTCCATGGCT
TGATGGCAGCCTTCCCGGAGACTTCGGTTTCGATCCTCTTGGTCTAGCAT
CTGATCCAGAGAGCTTGAGATGGAACCAACAGGCAGAACTTGTACACTGC
TGGTGAACAAGAATATTTCACGGACACAACGACTCTCTTCATCGTTGAAT
TGGTACTTATTGGTTGGGCTGAGGGAAGAAGATGGGCAGATATCATCAAG
CCTGGATGCGTTAACACGGATCCAATCTTTCCTAACAACAAGCTCACGGG
GACAGATGTTGG
Genomic location of T1140  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1790 marker 1790
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)