SGN Marker solcap_snp_sl_100353

SGN-M17914

Synonyms  
CL016043-0143
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54245)
Chromosome
8
Position
23.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTACGGGCTAACCAATCAGCTGAAGATGATACATCAAAGCAGAAAGAAGCCGTGAGTGGTGATGACTTTAGGAATGCCAAACCAACTGATTCTAATGGTA
  
3' flanking region
TTCCAAGGCAAACACTACTCAAAATGAAGTAGCCTCTCCTAAAGCGAAAGTGCAAAATGAGAACANNAACAATAGGAAATTTGACAAACAGGCTTCTGGA
SNP nucleotide
AG
SNPdb format
GTACGGGCTAACCAATCAGCTGAAGATGATACATCAAAGCAGAAAGAAGCCGTGAGTGGTGATGACTTTAGGAATGCCAAACCAACTGATTCTAATGGTA[A/G]
TTCCAAGGCAAACACTACTCAAAATGAAGTAGCCTCTCCTAAAGCGAAAGTGCAAAATGAGAACANNAACAATAGGAAATTTGACAAACAGGCTTCTGGA
  
Genomic location of solcap_snp_sl_100353  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17914 marker 17914
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)