SGN Marker solcap_snp_sl_100368

SGN-M17926

Synonyms  
CL016133-0426
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54257)
Chromosome
1
Position
78.30 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACGGAATTTACCTACCCCGTATCATNTTCGTAGCGGAAGATGATGAAGAAAACGACGACGGATTATCACAAAACGCAACGTTGGGGCTTGATCAAGTGGT
  
3' flanking region
ATCAATTCGTACCCGAAG
SNP nucleotide
AT
SNPdb format
ACGGAATTTACCTACCCCGTATCATNTTCGTAGCGGAAGATGATGAAGAAAACGACGACGGATTATCACAAAACGCAACGTTGGGGCTTGATCAAGTGGT[A/T]
ATCAATTCGTACCCGAAG
  
Genomic location of solcap_snp_sl_100368  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17926 marker 17926
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)