SGN Marker T1151

SGN-M1797
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBH34TH
Arabidopsis best BAC match: AC007138.1
Arabidopsis position: 4.0120000
Arabidopsis identities: 0.575
Best GenBank protein hit: AAD22649.1
Evalue: 1.2e-37
Identities: 0.497
Description: predicted protein of unknown function [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39519)
Chromosome
11
Position
86.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39520)
Chromosome
6
Position
7.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1151 was used as an overgo probe on plate 2 [well F3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P254O07,   P206E07,   P188E02,   P281A02,   P100N02,   P309A15,   P203D18

 Overgo Sequences

A sequence
TGTATTCGTCTCGGAGAGATCAGG
B sequence
GTAAATGCGAGGAGCACCTGATCT
AB sequence
TGTATTCGTCTCGGAGAGATCAGGTGCTCC
Marker sequence
GCCAAAACGTCATGCCTAACATGAAGAGTCCCCACCTACTTACGATCCGT
CGCCGTTTCCTACTGCAGCTCAGATTTCTCTATCATAACATTTGCCATTT
CCAGCCTGCAAAGCACATCAACCATAGTATCATGGATTCACAGTCGTCAC
CACATGGCTCTATTATCTTCTCCACCGTCGGCAGAACCAATTATGGCTTC
GACATCTTCTCCATCAAATCTCCATTTTCTTTTCTCAATTCTCCGGTAGA
ACATCGCCTCACAGACGGTACCTCCATCAATTACAACGGACAGTTTGTCG
ATGAAGATCAAACACTTGTATTCGTCTCGGAGAGATCAGGTGCTCCTCGC
ATTTACTTGAGACACCCCTCCTCTCAGGTACAGATGGAACAACTTCCTAC
TCCCATTGATAGCCTATTTCTCGACCGTCCATTTCTTCGAAATAAACAAC
TCTACTATATTTCAGCTCATCAGCAACCCAAAAAAGTTTTCACCAGCTCG
TCCGCTCTTTACTCTACCAATATAGAAGATAATAGTAACATCATCCGCTT
GACTCCGTACGGCTGCGTTGATTATAGTCCGGCGATTTCGCAGTCTGGAC
ACCTGATTGCGGTTGCATCTTACGGAGACCGTCGTTGGCCTACTGGTGAA
TTCCATGA
Genomic location of T1151  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1797 marker 1797
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)