SGN Marker solcap_snp_sl_100418

SGN-M17974

Synonyms  
CL016500-0535
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54305)
Chromosome
1
Position
84.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCAAAAGTCGTTCTCCAGCCACCAGACGTCATAAGAGTCGCTCTCCAAGGAACCATAGGAGACAGAGAAGTAGGAGTACCTCATTGTCTCCTATTGGTAA
  
3' flanking region
TCACCTGGTTCAAGTATC
SNP nucleotide
AG
SNPdb format
GCAAAAGTCGTTCTCCAGCCACCAGACGTCATAAGAGTCGCTCTCCAAGGAACCATAGGAGACAGAGAAGTAGGAGTACCTCATTGTCTCCTATTGGTAA[A/G]
TCACCTGGTTCAAGTATC
  
Genomic location of solcap_snp_sl_100418  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17974 marker 17974
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)