SGN Marker solcap_snp_sl_100430

SGN-M17986

Synonyms  
CL016576-0377
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54317)
Chromosome
2
Position
48.73 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCCTTTTGCATCAGAGGACAAGCTATAGAACCTACTTCCATTGTAAGTTTCTTTCTAACTTTCTTTACTCTACTCTGCAGTTTCTGTTTTCTAAGCTGA
  
3' flanking region
GTTTATCAGAAACAACCTTTCTATCTCATAGTGAGGTTGGGTTAGGGTAAGGTTTGCAAACTCTCTATCCTCTTCGAACCTCACTTGTGGTATTACACTG
SNP nucleotide
TG
SNPdb format
GCCCTTTTGCATCAGAGGACAAGCTATAGAACCTACTTCCATTGTAAGTTTCTTTCTAACTTTCTTTACTCTACTCTGCAGTTTCTGTTTTCTAAGCTGA[T/G]
GTTTATCAGAAACAACCTTTCTATCTCATAGTGAGGTTGGGTTAGGGTAAGGTTTGCAAACTCTCTATCCTCTTCGAACCTCACTTGTGGTATTACACTG
  
Genomic location of solcap_snp_sl_100430  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17986 marker 17986
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)