SGN Marker T1153

SGN-M1799
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBI05TH
Arabidopsis best BAC match: AC024261.4
Arabidopsis position: 1.0914000
Arabidopsis identities: 0.796
Best GenBank protein hit: AAG12768.1
Evalue: 1.4e-63
Identities: 0.603
Description: unknown protein; 27363-23366 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39522)
Chromosome
3
Position
168.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1153 was used as an overgo probe on plate 2 [well B1]

Plausible BAC Matches:   P326D18,   P224P23,   P028G08,   P264E04,   P173N19,   P107I09,   P222C21,   P104H02

 Overgo Sequences

A sequence
CCAAGCTGGTCTTTCTTTGTGTGG
B sequence
AAGGTTCCCAAGAGAGCCACACAA
AB sequence
CCAAGCTGGTCTTTCTTTGTGTGGCTCTCT
Marker sequence
GATGAGATGAGAATAGGGAAGGCAACTAGTAGCAGCACCACCAAGCTGGT
CTTTCTTTGTGTGGCTCTCTTGGGAACCTTTCTTCTTGTAGATCTGCTCT
GGGCTTCTTCCTCCTCCTTCAATTGGCCACTCCCACCATCATCCAATCTT
CTCTTCTTTCCTAATAACACGCTACCCATATCTAACAAAAAAGGAGGAGA
TGCCAGGATTTTATCGGCTACCTTTGCCGATTTGCCTGCCCCGCTACTGA
ACTGGGAGAAGATGGCACCATCACCTGTACCTCGTCTTGACGGCGCTGCA
CTACAGATCAACGACCTTCTTTTCGTCTTTGCTGGTTATGGAACCATTGA
TCATGTTCACTCGCATGTCGATATTTACAATTTCACCGCCAACTCATGGG
GAGGAACATTTGATATGCCCAAAGAAATGGCTCATTCACACTTGGGTATG
GTAACTGATGGGAGATACATTTATGTGGTTACTGGACAATACGGTCCCCA
GTGCCGGGGTCCTACTGCCCGCAATTATGTTCTTGACACCAAAACCAAGC
AATGGCAGGACTTGCCTCCTTTACCACTCCCAAGGTATGCGCCTGC
Genomic location of T1153  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1799 marker 1799
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)