SGN Marker T1155

SGN-M1800
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBI10TH
Arabidopsis best BAC match: AB023044.1
Arabidopsis position: 5.1960000
Arabidopsis identities: 0.655
Best GenBank protein hit: BAA97377.1
Evalue: 1.5e-77
Identities: 0.795
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39523)
Chromosome
3
Position
74.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1155 was used as an overgo probe on plate 9 [well A1]

Plausible BAC Matches:   P305K18,   P002D23,   P310A19

 Overgo Sequences

A sequence
GGACTCTTGCCTTGTATCTTCTGG
B sequence
CACTGAGACAGCCTTGCCAGAAGA
AB sequence
GGACTCTTGCCTTGTATCTTCTGGCAAGGC
Marker sequence
CCTATTCTTCTCTACTCGATCTCAAGCCAACTTGTGTCCGAAAAAGACCT
AATTGTAAGAGAGGAAGCATGTCGAATTGGTTTGCTCTTTGGGGGATTTA
GTGGTTCATATCATGCTCTAAGATGTTTGCTAAGAAAGCTGAGAAGAAAA
GAGACACCCCTAAATGCAATTTTAGCAGGTTCAGTGGCAGGTCTGTCTAT
TTTAGCATTAGATGATTCCAACAGGCGGCGGACTCTTGCCTTGTATCTTC
TGGCAAGGCTGTCTCAGTGTGCGTATAATTCTGCCAAATCCAAGAACCAG
TTTCATCTCTGGGGAAGTCACTGGAGTCATGGGGATTCTTTACTCTTTGC
ATTCGCATGTGCCCAGGTTATGTATTCCTTCATAATGCGTCCTGAGAGCC
TTCCAAAAGCATATAGAGATTTCATTCAGAAGACTGGGCCTGTTGCAGCA
CCAGTATACAAAGCTGTTAAGGATTGCTGTAGAGGCTCTCCAGTTGATGT
TGCTTCATTACATGCCTATTTGTCCAAAGCAAAGGGCTCTACTACTATAA
AGTTGGAAGAGTTTCCTTCTATTATTCCATGCTCTGTAATTCACCCTGGG
ACCAAATCTTGCTTAGTTCACGATGCT
Genomic location of T1155  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1800 marker 1800
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)