SGN Marker solcap_snp_sl_100469

SGN-M18023

Synonyms  
CL016815-0132
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54354)
Chromosome
7
Position
57.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCTCAATGTCTGGCTTGCTTCNAGTTNTAGAGGGC
  
3' flanking region
GATAATCCAAGACTGGGCTTCTTTGTGTTTTGTTGAAAATCTATATATAAAAAAGACTTAGTTGGTTGAATGNTACTCGAATCCACTATCCATNAAGTGT
SNP nucleotide
AG
SNPdb format
ATCTCAATGTCTGGCTTGCTTCNAGTTNTAGAGGGC[A/G]
GATAATCCAAGACTGGGCTTCTTTGTGTTTTGTTGAAAATCTATATATAAAAAAGACTTAGTTGGTTGAATGNTACTCGAATCCACTATCCATNAAGTGT
  
Genomic location of solcap_snp_sl_100469  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18023 marker 18023
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)