SGN Marker solcap_snp_sl_100472

SGN-M18025

Synonyms  
CL016852-0345
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54356)
Chromosome
2
Position
28.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGAGTTGTATAAAGAGAGTCGATCTGAGTCGAATGTTGGGGTGATGTTTGATGATTATGGGAGGCCTATTAATGTTCAAAATCAGAGGGAGAAGCAGGG
  
3' flanking region
TATGAGAGTAGTCGTAAAATTGTGAANGCAACCCCGAAGATGGAGGAACAACAGGATGTTACAGCTGGTGTGTTGAAGTTCCGCGTCAAACTTTTATCTG
SNP nucleotide
AT
SNPdb format
ATGAGTTGTATAAAGAGAGTCGATCTGAGTCGAATGTTGGGGTGATGTTTGATGATTATGGGAGGCCTATTAATGTTCAAAATCAGAGGGAGAAGCAGGG[A/T]
TATGAGAGTAGTCGTAAAATTGTGAANGCAACCCCGAAGATGGAGGAACAACAGGATGTTACAGCTGGTGTGTTGAAGTTCCGCGTCAAACTTTTATCTG
  
Genomic location of solcap_snp_sl_100472  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18025 marker 18025
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)