SGN Marker T1158

SGN-M1803
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.01
Tomato EST read: TFBBI51TH
Arabidopsis best BAC match: AB028614.1
Arabidopsis position: 3.1062000
Arabidopsis identities: 0.613
Best GenBank protein hit: BAB10129.1
Evalue: 1.1e-58
Identities: 0.584
Description: proline oxidase precursor [Arabidopsis thaliana]
Comment: conversion of proline to glutamic acid
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39524)
Chromosome
2
Position
111.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1158 was used as an overgo probe on plate 11 [well E3]

Plausible BAC Matches:   P237P06,   P167P17,   P007P12,   P150M11

 Overgo Sequences

A sequence
GTATCAAACCAGAGCCTCTATCGG
B sequence
TCACGCTCTTCCTCTACCGATAGA
AB sequence
GTATCAAACCAGAGCCTCTATCGGTAGAGG
Marker sequence
TGTACCCCAAGGCTTCTCAACAGAATGAGTGATTTGTTAAGATGGGAACA
CAAAGATCCATCATTTAATCTTCCATGGAAGCGAGAGTCGCTTCCCCTTT
TCGCCACATCGAGCCCTGTTTATCACACTTGTATCAAACCAGAGCCTCTA
TCGGTAGAGGAAGAGCGTGATCTTCAATTAGCTCATGAAAGACTTACAAA
AATTTGCGAGAAATGTTGGGAACATGAAGTTCCATTACTAATTGATGCGG
AAGACACAACCATTCAACCTGCAATTGATTATTTTGCGTATTCAGCAGCT
ATTAAGTATCACAAAGATGATCAGCCTTTGATATTCGGAACAATCCAAGC
TTACTTGAAGGACGCCAAGGAACGAATGGTTATTGCGAAAAAGGCTGCAG
AGAAAATGGGAGTTCCAATGGGATTTAAGCTTGTGAGGGGCGCTGATATG
TGTAGTGAAAAAGAATTGGCTTCTACATTAGGATTCAACTGTCCAATTCA
CGACAGTATTGAGCAAACACACGCTTGCTTC
Genomic location of T1158  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1803 marker 1803
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)