SGN Marker solcap_snp_sl_100489

SGN-M18039

Synonyms  
CL016923-0271
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54370)
Chromosome
9
Position
6.01 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAATGCAAACCTTCACTTCCACCAGCAGCAAGTATANCACCACATNCCGCGCCTATCCATCACTAAGAAGTTGACCTCGACGCCAAAGGGATGTCAGAA
  
3' flanking region
AGAGTCAAAAATNTCCTTAGACTATATNTTGTGTATTATATACATGGGGTTGTTGCAATACTTCCCTTACATGTGGTGTGTGTCAA
SNP nucleotide
CG
SNPdb format
TCAATGCAAACCTTCACTTCCACCAGCAGCAAGTATANCACCACATNCCGCGCCTATCCATCACTAAGAAGTTGACCTCGACGCCAAAGGGATGTCAGAA[C/G]
AGAGTCAAAAATNTCCTTAGACTATATNTTGTGTATTATATACATGGGGTTGTTGCAATACTTCCCTTACATGTGGTGTGTGTCAA
  
Genomic location of solcap_snp_sl_100489  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18039 marker 18039
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)