SGN Marker solcap_snp_sl_100491

SGN-M18041

Synonyms  
CL016930-0317
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54372)
Chromosome
9
Position
49.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGGGAAATGGTTAAAGATTGCTTCACAGCTAANAATGACAAAATATTTGCTAGTAGACCAAATATGGCAATAAGCAAGTATTTAGGCTATAATGGAGCC
  
3' flanking region
TTTTCGCTTTAGCCCCTTACGGACCATACTGGCGTAANATACGTAAAATGGTAACTCTTGAACTCTTAACCAACAGTCGCCTTGAGAAGCTAAAACATGT
SNP nucleotide
AG
SNPdb format
TTGGGAAATGGTTAAAGATTGCTTCACAGCTAANAATGACAAAATATTTGCTAGTAGACCAAATATGGCAATAAGCAAGTATTTAGGCTATAATGGAGCC[A/G]
TTTTCGCTTTAGCCCCTTACGGACCATACTGGCGTAANATACGTAAAATGGTAACTCTTGAACTCTTAACCAACAGTCGCCTTGAGAAGCTAAAACATGT
  
Genomic location of solcap_snp_sl_100491  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18041 marker 18041
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)