Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_100501

SGN-M18051

Synonyms  
CL017051-0523
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54382)
Chromosome
11
Position
52.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGGTTCACAGCTTATTCACTCNTTTTTCTTTTAGCTCTCGCTTATCTNTTCTCCACGATATAGTTGCAACAAATTACTCNCTTNCTTTATAAGCTTATAT
  
3' flanking region
ATTTTGTTTACAATGCAGCCTTTCACCTCCAACTCGAGAAAGATCCCGCTCCTANTTTGCTCTGTATCAGCCTCTGACCTGAGTCATA
SNP nucleotide
AT
SNPdb format
AGGTTCACAGCTTATTCACTCNTTTTTCTTTTAGCTCTCGCTTATCTNTTCTCCACGATATAGTTGCAACAAATTACTCNCTTNCTTTATAAGCTTATAT[A/T]
ATTTTGTTTACAATGCAGCCTTTCACCTCCAACTCGAGAAAGATCCCGCTCCTANTTTGCTCTGTATCAGCCTCTGACCTGAGTCATA
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_100501  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18051 marker 18051
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)