SGN Marker solcap_snp_sl_100503

SGN-M18053

Synonyms  
CL017069-0086
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54384)
Chromosome
6
Position
3.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAGGTACAGATGGAACAACTTCCTACTCCCATTGATAGCCTATTTCTCGACCGTCCATTTCTTCGAAATAAAC
  
3' flanking region
ACTCTACTATATTTCAGNTCATCAGCAANCCAAANAAGTTTTCACCAGCTCGTCCGCTCTTTACTCTACCAATATAGANGATNNTAGTAACATCATCCGC
SNP nucleotide
AG
SNPdb format
TCAGGTACAGATGGAACAACTTCCTACTCCCATTGATAGCCTATTTCTCGACCGTCCATTTCTTCGAAATAAAC[A/G]
ACTCTACTATATTTCAGNTCATCAGCAANCCAAANAAGTTTTCACCAGCTCGTCCGCTCTTTACTCTACCAATATAGANGATNNTAGTAACATCATCCGC
  
Genomic location of solcap_snp_sl_100503  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18053 marker 18053
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)