SGN Marker T1161

SGN-M1806
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 3.16
Tomato EST read: TFBBJ25TH
Arabidopsis best BAC match: AC007727.2
Arabidopsis position: 1.0460000
Arabidopsis identities: 0.809
Best GenBank protein hit: AAD41422.1
Evalue: 8.1e-70
Identities: 0.914
Description: "Similar to gb|M87339 replication factor C, 37-kDa subunit from Homo sapiens and is a member of PF|00004 ATPases associated with various cellular activities[Arabidopsis thaliana]"
Comment: replicative polymerase accessory protein
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39525)
Chromosome
11
Position
38.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1161 was used as an overgo probe on plate 10 [well E1]

Plausible BAC Matches:   P333H02,   P318G17,   P303A09,   P051P03,   P296A09,   P033O16,   P227L05,   P006G15,   P199K24,   P139H04,   P257G10,   P056J15,   P317C10,   P041A01,   P197I19,   P159M07,   P062I24,   P165I01,   P218O08

 Overgo Sequences

A sequence
ATCGACCGAAGCAAGTGAAGGATG
B sequence
TCATCCTGGTGAGCTACATCCTTC
AB sequence
ATCGACCGAAGCAAGTGAAGGATGTAGCTC
Marker sequence
AGTTATGCAGAGCTCTCAGCCATGGGTCGAGAAATATCGACCGAAGCAAG
TGAAGGATGTAGCTCACCAGGATGAAGTCGTTCGAGTCCTCACCAACACT
CTCGAGACTTCTAACTGCCCGCATATGTTGTTATATGGTCCTCCTGGAAC
TGGAAAGACAACCACTGCTCTTGCCATTGCCCATCAGCTTTTCGGACCTG
AGCTGTATAAATCGAGGGTATCGGAGCTAAATGCTAGTGATGACCGTGGT
ATCAATGTAGTTCGTACAAAAATTAAGAACTTTGCTGCTGCTGCTGTAGG
CTCTAATCGGCAAAGTGGTTATCCTTGCCCACCTTTTAAGATCATAATCC
TTGATGAAGCAGATTCAATGACTCAAGATGCTCAAAATGCCTTGCGACGA
ACTATGGAGACATATTCAAAA
Genomic location of T1161  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1806 marker 1806
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)