SGN Marker T1164

SGN-M1808
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBJ43TH
Arabidopsis best BAC match: AB012246.1
Arabidopsis position: 5.0290000
Arabidopsis identities: 0.621
Best GenBank protein hit: BAB09478.1
Evalue: 3.0e-37
Identities: 0.587
Description: galactose-1-phosphate uridyl transferase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49398)
Chromosome
10
Position
46.45 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47333)
Chromosome
10
Position
31.77 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39527)
Chromosome
10
Position
34.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1164 was used as an overgo probe on plate 15 [well G5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTTCTCTAGTCGGAGACGTATCG
B sequence
ACCCGAATCCACTAACCGATACGT
AB sequence
GTTTCTCTAGTCGGAGACGTATCGGTTAGT
Marker sequence
CGGAGCCCCGAAATCCGTAAAGACAAAATCCACAACAGGTGGATACTGTT
CTCTCCGGCGAGATCGCGCCGACCGTCGGACTTCAAGGCCAAATCGAATC
CACATCCGAACAATCAAACAGAATGCCCATTTTGCGCCGGCCACGAGCAC
GAGTGTGCGCCGGAGATATTCCGTGTGCCAGCAGATTCCACCAACGATTG
GAAAATCAGAGTTATCCAGAACCTTTATCCGGCAGTCAGCAGAGAGTTGG
ATTTCCAAAATCCAGTTTCTCTAGTCGGAGACGTATCGGTTAGTGGATTC
GGGTTTCACGATGTGGTTATTGAATCGTCGGTTCATTCACTAAATCTGAG
TGATCTTTCTGCGGCATCAAGTTGGGGAGGTTCTGCTAGCTTGTTAGAAG
AGGATCGAGCAGCTTCGAAGTTGTGATTCTATCAAGTATGTTCAGGTGTT
GAAAGACCATGGAGCCTCTGCTGGTGCTTCGATGAGCCATTCTCACAGTC
AGATGATTG
Genomic location of T1164  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1808 marker 1808
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)