SGN Marker TG479

SGN-M181

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTCAGCTAGTAGACTACGATTACGATGATTACGAATATGAAGAGTTTCAGAACCGGAGCTGCGTAATGGAGGAATCTGAGGGATCGGTTC
CTCGAAGGGGAGTGCAGTGGGTGATTATGGGTGATCCTATGGCACAGAGACACGTGTATGCCCAGTGGCTCTCGAAGCTTCTAGGTGTCC
CTCATATTTCCATGGGTTCACTCGTTCGCCAAGAGCTCCACCCTCGTTCTTCTCTCTACAAGCAGGTTTTTGTTTATTCTGCATTTCTGT
TTGTTTGAGCTTTCAATCTATCTGCAATGGAAATATGAAAATAAAGATTGTTCTTTTAGTTATTAGCTGGTCATATTTTTGACAAATTGT
TAAAATAATTGAAAGAATTAACTTTGAATTGAGGGATTGAATTACAAAATTTACATATAATTGATCTATGCTAGCTCAGAATGAAAAGTT
TATAAGCTTGATTGAGCTCAAACCT
Reverse sequence
AAACATCACTTTTGAAACATATAGATATTTGCACAAACAAAGTAAAACTACGTGAGAAGACCAAGTGAGTACCAACAGTTCCACAACAAA
TGGCATAGATATATAAACAATTCAGTGTGGTTACGTCAACTAGCAATCAGGTACTCCGTATATTAGCTATCAAACAAAAGATCTTTGATT
TGATTTTTCCTCAAACAAGATACTTGAAGGCCTAAAATGACATTTTGAAACAGCACATTTGCATGTTGAATTCAGCAAGCACTAGTATTT
ACACACATCAAGAATGCTAAGGAGGGAATCTATAGTCCAATTCATTGAATGTTAAAAGAGGCAATCTACAATTTCATTCATCTCAAGTTA
CAATATCAATTTTTTTAGAGTATCTGCAACTGTAAAATTTAAAGCATCATTAGGTACCTGCTCTGCATGCACATGCAGGTTCTTCCTCGA
GACATCTTCCATGATACTTGAAGGCCTAAAATGACCACCCTCTGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1704751.4e-0780 (16.8% of RFLP seq)+
SGN-U1446764e-137245 (51.6% of RFLP seq)+
SGN-U1446761.2e-3280 (16.2% of RFLP seq)-
SGN-U1446731.3e-3880 (16.2% of RFLP seq)-
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50398)
Chromosome
3
Position
35.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Eggplant-COSII   
Map version
63 (location: 42473)
Chromosome
3
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40059)
Chromosome
3
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8468)
Chromosome
3
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8467)
Chromosome
3
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG479 was used as an overgo probe on plate 2 [well A8]

Plausible BAC Matches:   P092H05,   P209L16,   P162M04,   P020P05,   P021D23

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTTCAGAACCGGAGCTGCGTAATG
B sequence
ATCCCTCAGATTCCTCCATTACGC
AB sequence
TTTCAGAACCGGAGCTGCGTAATGGAGGAA
Marker sequence
CTCAGCTAGTAGACTACGATTACGATGATTACGAATATGAAGAGTTTCAG
AACCGGAGCTGCGTAATGGAGGAATCTGAGGGATCGGTTCCTCGAAGGGG
AGTGCAGTGGGTGATTATGGGTGATCCTATGGCACAGAGACACGTGTATG
CCCAGTGGCTCTCGAAGCTTCTAGGTGTCCCTCATATTTCCATGGGTTCA
CTCGTTCGCCAAGAGCTCCACCCTCGTTCTTCTCTCTACAAGCAGGTTTT
TGTTTATTCTGCATTTCTGTTTGTTTGAGCTTTCAATCTATCTGCAATGG
AAATATGAAAATAAAGATTGTTCTTTTAGTTATTAGCTGGTCATATTTTT
GACAAATTGTTAAAATAATTGAAAGAATTAACTTTGAATTGAGGGATTGA
ATTACAAAATTTACATATAATTGATCTATGCTAGCTCAGAATGAAAAGTT
TATAAGCTTGATTGAGCTCAAACCT

TG479 was used as an overgo probe on plate 1 [well A3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P209L16,   P092H05,   P020P05

 Overgo Sequences

A sequence
TTTCAGAACCGGAGCTGCGTAATG
B sequence
ATCCCTCAGATTCCTCCATTACGC
AB sequence
TTTCAGAACCGGAGCTGCGTAATGGAGGAA
Marker sequence
CTCAGCTAGTAGACTACGATTACGATGATTACGAATATGAAGAGTTTCAG
AACCGGAGCTGCGTAATGGAGGAATCTGAGGGATCGGTTCCTCGAAGGGG
AGTGCAGTGGGTGATTATGGGTGATCCTATGGCACAGAGACACGTGTATG
CCCAGTGGCTCTCGAAGCTTCTAGGTGTCCCTCATATTTCCATGGGTTCA
CTCGTTCGCCAAGAGCTCCACCCTCGTTCTTCTCTCTACAAGCAGGTTTT
TGTTTATTCTGCATTTCTGTTTGTTTGAGCTTTCAATCTATCTGCAATGG
AAATATGAAAATAAAGATTGTTCTTTTAGTTATTAGCTGGTCATATTTTT
GACAAATTGTTAAAATAATTGAAAGAATTAACTTTGAATTGAGGGATTGA
ATTACAAAATTTACATATAATTGATCTATGCTAGCTCAGAATGAAAAGTT
TATAAGCTTGATTGAGCTCAAACCT
Genomic location of TG479  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D181 marker 181
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)