SGN Marker T1169

SGN-M1810
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13.01
Tomato EST read: TFBBK22TH
Arabidopsis best BAC match: AB017063.1
Arabidopsis position: 5.1950000
Arabidopsis identities: 0.896
Best GenBank protein hit: CAA58111.1
Evalue: 2.2e-95
Identities: 0.988
Description: ubiquitin conjugating enzyme [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49399)
Chromosome
6
Position
41.15 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47334)
Chromosome
6
Position
78.08 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39529)
Chromosome
6
Position
67.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1169 was used as an overgo probe on plate 3 [well H5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TACAATCCCTGGTCCTGTTGGTAC
B sequence
ACCGCTTTCGTAAGGAGTACCAAC
AB sequence
TACAATCCCTGGTCCTGTTGGTACTCCTTA
Marker sequence
GCAGTGGCGACTTTTGCATAAACCAAAATTAGAATCAAATTGGAAGAGAG
AAAAAAAAATGGTGGACTTGGCTAGGGTTCAAAAAGAGCTCCATGAATGC
AACAGAGATGTTCAAGTTTCTGGAATTAATGTTACCCTTAAAGGAGACAG
TCTCACTCACTTGATTGGTACAATCCCTGGTCCTGTTGGTACTCCTTACG
AAAGCGGTACTTTCAAGATCGATATCACTCTTACTGATGGCTACCCATTT
GAGCCTCCAAAAATGAAATTCGCCACAAAAGTTTGGCATCCCAACATAAG
TAGTCAAAGTGGAGCAATATGCCTAGACATCCTGAAGGACCAGTGGAGCC
CAGCACTAACTCTCAAGACAGCTCTCCTTTCTATACAAGCATTACTTTCT
GCTCCTGAACCTGATGATCCACAAGATGCAGTTGTTGCACAGCAGTATCT
TAGAGAACATCAGACCTTTGTCGGCACAGCTCGTTACTGGACTGAGACTT
TTGCAAAAACATCCACACTTGCTGCAGACGACAAGATACAAAAGCTTGTG
GAAATGGGCTTTCCTGAAACTCAA
Genomic location of T1169  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1810 marker 1810
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)