SGN Marker solcap_snp_sl_100558

SGN-M18105

Synonyms  
CL017414-0044
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54436)
Chromosome
2
Position
41.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAGGGAAAAGCTAACTGA
  
3' flanking region
TTGGAGAAAGTTGACACTGCACTCAACAGCTTGCTGGATCATGTTTCTGGACATGAAGAGGAAGTGGAAAGTTTTGAATTTGCNCAAAAGAATCTGGAGA
SNP nucleotide
AG
SNPdb format
AAAGGGAAAAGCTAACTGA[A/G]
TTGGAGAAAGTTGACACTGCACTCAACAGCTTGCTGGATCATGTTTCTGGACATGAAGAGGAAGTGGAAAGTTTTGAATTTGCNCAAAAGAATCTGGAGA
  
Genomic location of solcap_snp_sl_100558  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18105 marker 18105
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)