SGN Marker solcap_snp_sl_100577

SGN-M18123

Synonyms  
CL017477-0069
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54454)
Chromosome
2
Position
32.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTATCTTCNCCTCACATGCGAGCTTTCCATCTCGCATGGCTCTCTCTATTTTC
  
3' flanking region
TGTTTCTTCTCTACTTTCGCAATCCCTCCACTTCTCGAAGTTATTCGTAAGGATCTCAATCTCACCCAAACTGATATCGGCACAGCCGGAATCGCCTCCT
SNP nucleotide
AG
SNPdb format
ATTATCTTCNCCTCACATGCGAGCTTTCCATCTCGCATGGCTCTCTCTATTTTC[A/G]
TGTTTCTTCTCTACTTTCGCAATCCCTCCACTTCTCGAAGTTATTCGTAAGGATCTCAATCTCACCCAAACTGATATCGGCACAGCCGGAATCGCCTCCT
  
Genomic location of solcap_snp_sl_100577  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18123 marker 18123
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)