SGN Marker solcap_snp_sl_100581

SGN-M18126

Synonyms  
CL017497-0234
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54457)
Chromosome
7
Position
60.62 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAGCCTTTAGTTACTATTGTTATATCCGTAATAAAGTTGCCAAGCGTCTCAAGAACCGCACTTGTAAGTATTGTTTTTATAATTTTTGTAAGNTGGTTAC
  
3' flanking region
AGTGTTTTCAAGAATTAGGTACATTTTTTGAGTTGTGGCTTTGGGGGGTTCTTGANTATTGCAGAAAGTTTTNATCTTTATGAAGATATNGGTTGAAATG
SNP nucleotide
TC
SNPdb format
TAGCCTTTAGTTACTATTGTTATATCCGTAATAAAGTTGCCAAGCGTCTCAAGAACCGCACTTGTAAGTATTGTTTTTATAATTTTTGTAAGNTGGTTAC[T/C]
AGTGTTTTCAAGAATTAGGTACATTTTTTGAGTTGTGGCTTTGGGGGGTTCTTGANTATTGCAGAAAGTTTTNATCTTTATGAAGATATNGGTTGAAATG
  
Genomic location of solcap_snp_sl_100581  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18126 marker 18126
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)