SGN Marker solcap_snp_sl_100584

SGN-M18129

Synonyms  
CL017502-0724
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54460)
Chromosome
6
Position
0.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTAGTGTACCATCCATGCTTAAAAAAGTATGCAAACAATTTTATTATAAGTTGCTCTTGGCTACTGCATCTNGAATATGAGTTGTACACAATATCTATTA
  
3' flanking region
TGAAGAAAAAGAGCAATATACATGTTTATTTTAGGTATGCTACGGAGCATAGATG
SNP nucleotide
CG
SNPdb format
GTAGTGTACCATCCATGCTTAAAAAAGTATGCAAACAATTTTATTATAAGTTGCTCTTGGCTACTGCATCTNGAATATGAGTTGTACACAATATCTATTA[C/G]
TGAAGAAAAAGAGCAATATACATGTTTATTTTAGGTATGCTACGGAGCATAGATG
  
Genomic location of solcap_snp_sl_100584  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18129 marker 18129
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)