SGN Marker T1174

SGN-M1814
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.05
Tomato EST read: TFBBL15TH
Arabidopsis best BAC match: AC008113.4
Arabidopsis position: 1.1330000
Arabidopsis identities: 0.559
Best GenBank protein hit: AAF26949.1
Evalue: 2.8e-45
Identities: 0.604
Description: similar ot b-keto acyl reductase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39532)
Chromosome
5
Position
66.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1174 was used as an overgo probe on plate 1 [well H10]

Plausible BAC Matches:   P004F23,   P007B09,   P250I09,   P272O10,   P232B20,   P089P03,   P012P24,   P075O13,   P025F15,   P245G17,   P164B09,   P232C16,   P303I05,   P291G06,   P006N06,   P118I20,   P197B09,   P113P12,   P096A08,   P310N07,   P256P09,   P073B05,   P043B12,   P228D21

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCTTATGGCTCTTGGGCACTCATC
B sequence
CATCTGTTGAGCCAGTGATGAGTG
AB sequence
TCTTATGGCTCTTGGGCACTCATCACTGGC
Marker sequence
GCCTATTTTCTTCTCCAACAACTCAAGAAAATGCTTTCAACTATGGTGAT
TCACCTCAAAACTCAACCTCTCTTTGGTCTTCTTCTCTCCTTCATTGGAT
TCATCACCTTCTTAAAAAACTTCATCATTTTCCTCAAATGGATTTTCATT
ACATTTTTAAGAACTCCAAAGAATCTTGTCCAATCTTATGGCTCTTGGGC
ACTCATCACTGGCTCAACAGATGGAATTGGAAAAGCTTTTGCTTTTCAAC
TTGCACAAAAAGGTCTCAACCTAATACTAGTAGCAAGAAATTTAAACAAA
CTACAACAAGTCTCTAGTGAAATCAAAACTCAAAATCCAAATATCAAAGT
CAAGATTATTGTTGTAGATTTCTCTTTTGATGTTACTAAAGGGATTCAAG
AAATGAAAAAAGGAATTGAAGGATTGGACATAGGTGTTTTAATTAATAAT
GTTGGTGTCACATATCCAAGAGCTATGTTGTTTCATGAGGTGGATGAGAA
TATATGGAAAAATATAGTGAAAGTCAATTTGGAAGGTACCACATCAGTGA
CGATGGCGGTTTTACCAAACATGATAGGTAG
Genomic location of T1174  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1814 marker 1814
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)