SGN Marker solcap_snp_sl_100596

SGN-M18141

Synonyms  
CL017592-0053
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54472)
Chromosome
8
Position
47.21 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGGTAGCNGA
  
3' flanking region
AACGACACTGATTCGATACCTGATCCTGAAAAAAGTGTTGACATACATGGTGTTTTGAAAGACTTGAATATTGAAGGAAGCATTGATTATGGAGTTACGG
SNP nucleotide
CG
SNPdb format
ATTGGTAGCNGA[C/G]
AACGACACTGATTCGATACCTGATCCTGAAAAAAGTGTTGACATACATGGTGTTTTGAAAGACTTGAATATTGAAGGAAGCATTGATTATGGAGTTACGG
  
Genomic location of solcap_snp_sl_100596  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18141 marker 18141
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)