Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_100597

SGN-M18142

Synonyms  
CL017592-0207
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54473)
Chromosome
8
Position
47.21 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGAAAGACTTGAATATTGAAGGAAGCATTGATTATGGAGTTACGGCGATAAGTTTAGGCAGTACAGATTTCGGCGGCTTATATTCAGAGAAGCCTTTA
  
3' flanking region
CCGTTATACGTCCAGCCGGAGCCGATGACGTTGTGCGGGTNATTAGGCGAGCGTTAGAGTCACCAACATTAACTGTAGCGGCGAGAGGNAACGGTCATTC
SNP nucleotide
AG
SNPdb format
TTTGAAAGACTTGAATATTGAAGGAAGCATTGATTATGGAGTTACGGCGATAAGTTTAGGCAGTACAGATTTCGGCGGCTTATATTCAGAGAAGCCTTTA[A/G]
CCGTTATACGTCCAGCCGGAGCCGATGACGTTGTGCGGGTNATTAGGCGAGCGTTAGAGTCACCAACATTAACTGTAGCGGCGAGAGGNAACGGTCATTC
  
Genomic location of solcap_snp_sl_100597  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18142 marker 18142
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)