SGN Marker solcap_snp_sl_100600

SGN-M18145

Synonyms  
CL017605-0415
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54476)
Chromosome
7
Position
63.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTATTGGAAGAAGGCTGAAGCTGTNAGGATCAAGTGCTTGGGNGTGCCAACTCTTGACATGGATAACGTATGCTCTCATCTCGAGGTTTGTGATCTGAAT
  
3' flanking region
CCAGAGTGCTGGCACATNTATTTGGATGTAGATTTCTTTAACCTTTNACAAATGAACACTTCTGTCNCTG
SNP nucleotide
AG
SNPdb format
CTATTGGAAGAAGGCTGAAGCTGTNAGGATCAAGTGCTTGGGNGTGCCAACTCTTGACATGGATAACGTATGCTCTCATCTCGAGGTTTGTGATCTGAAT[A/G]
CCAGAGTGCTGGCACATNTATTTGGATGTAGATTTCTTTAACCTTTNACAAATGAACACTTCTGTCNCTG
  
Genomic location of solcap_snp_sl_100600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18145 marker 18145
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)