SGN Marker T1177

SGN-M1816
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.05
Tomato EST read: TPTAA06TH
Arabidopsis best BAC match: AF177535.1
Arabidopsis position: 5.0690000
Arabidopsis identities: 0.793
Best GenBank protein hit: AAD56326.1
Evalue: 3.0e-72
Identities: 0.660
Description: "putative mRNA capping enzyme, RNA guanylyltransferase [Arabidopsis thaliana]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39534)
Chromosome
9
Position
47.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1177 was used as an overgo probe on plate 15 [well C9]

Plausible BAC Matches:   P225F21,   P048J24,   P108I03,   P300E15,   P326I17

 Overgo Sequences

A sequence
CACAATTTCCTGGCTCACATCCAG
B sequence
TCCCTGTCAAGAGAGACTGGATGT
AB sequence
CACAATTTCCTGGCTCACATCCAGTCTCTC
Marker sequence
GGCAAAATCATTTACGACAGTTCTGTTATCAAGCACTGAAAATGACCCCA
GGGGGTAGAGGCCCACAATTTCCTGGCTCACATCCAGTCTCTCTTGACAG
GGAAAACTTGCAGTTATTAAGGCAGCGTTACTACTATGCCACTTGGAAGG
CTGATGGGACACGGTATATGATGCTGATCACGATGGATGGTTGTTTCTTA
ATTGATAGGCATTTCAACTTTCGGAGGGTTCAGATGAGATTTCCTTGCAG
ACACACTAATGAAGGTTTAGCCGAAAAGACCCACCACTTCACCTTACTTG
ATGGAGAGATGGTAATTGATACTTTGCCTGACACACAGAAGCACGAAAGG
AGATACCTAATTTATGATATGATTGCTTTGAACCAATTGTCTGTCATTGA
GCGACCCTTTTATGAACGGTGGAGAATGATCGACAAAGAAGTGATTGGTC
CAAGGAATTATGAACGTCAACATATATACCAGAGTAGAAACCCTTATTAT
AGATATGAGTTGGAGCCTTTCAGGGTGAGGAGGAAGGATTTTTTTCTGCT
CTCTACTGTCACGAAACTTCTCAAAGAATGTATCCCAAAGCTTTCACATG
AAGCTGATGGTCTTA
Genomic location of T1177  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1816 marker 1816
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)