SGN Marker solcap_snp_sl_100626

SGN-M18169

Synonyms  
CL017729-0357
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54500)
Chromosome
9
Position
1.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATCTTGCATTTGGAGAAACTTTGAAGGTATGCATGTCNTTGTATTGAAATGCCATNAAATNCAGNGCTATGATGAAATTGGTANGAGAAAAAAAAGTTA
  
3' flanking region
GAATTTCCTACCATTCAAAAGTAAACGCAGTTCCCCTAAGAAGCTGGTGGGTTTCATAGAATCATATTCATACTAAAATAGCTGTCAAATTTNGGTGTTA
SNP nucleotide
TC
SNPdb format
AATCTTGCATTTGGAGAAACTTTGAAGGTATGCATGTCNTTGTATTGAAATGCCATNAAATNCAGNGCTATGATGAAATTGGTANGAGAAAAAAAAGTTA[T/C]
GAATTTCCTACCATTCAAAAGTAAACGCAGTTCCCCTAAGAAGCTGGTGGGTTTCATAGAATCATATTCATACTAAAATAGCTGTCAAATTTNGGTGTTA
  
Genomic location of solcap_snp_sl_100626  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18169 marker 18169
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)