SGN Marker T1181

SGN-M1818
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 9.01
Tomato EST read: TPTAA15TH
Arabidopsis best BAC match: AB025613.1
Arabidopsis position: 5.1850000
Arabidopsis identities: 0.791
Best GenBank protein hit: AAC49704.1
Evalue: 8.0e-96
Identities: 0.866
Description: "endo-1,4-beta-glucanase [Lycopersicon esculentum]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49401)
Chromosome
5
Position
0.08 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39536)
Chromosome
5
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1181 was used as an overgo probe on plate 1 [well E1]

Plausible BAC Matches:   P010E12,   P087O08,   P018J11,   P197F10,   P197H11,   P197E10,   P197O10,   P221H23

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCAGCTCTACAGGATGGGAAATCC
B sequence
AGGTAGTGGAACCATCGGATTTCC
AB sequence
TCAGCTCTACAGGATGGGAAATCCGATGGT
Marker sequence
GGATCCATGGGGAGGTGCATTAGAAATTAATGCAACAGATTCAGCAACTG
ATGATGATCGGAGCAGGAACTTGCAGGATTTTGATAAAGCAGCTTTGTCA
CGAAATTTAGATGAAACGCAGCAAAGTTGGTTATTAGGTCCTACAGAGCA
AAAGAAGAAGAAATATGTAGATCTGGGTTGTATTATTGTTAGTAGAAAAG
TATTCAAATGGACTCTCGGTTGTATTATTGCAGCTGCACTTATTGCTGGA
TTTGTTACTCTTATTGTAAAAACTGTACCGAAGCACCGACACCATAATCC
TCCACCAGATAACTACACTTTAGCTCTTCGTAAAGCTATCATGTTCTTCA
ATGCTCAGCGCTCTGGGAAACTTCCTAAGCATAATAATGTGTCATGGAGG
GGGAGTTCAGCTCTACAGGATGGGAAATCCGATGGTTCCACTACCTTTAA
GAATTTGGTTGGGGGTTATTATGATGCAAGAGATGCCATCAAGTTTAATT
TCCCTCAATCTTTTGCTTTAACTGTCTTGAGTTGGAGTGTGATTGAGTAT
CCTGCANAATATGAAGCTGCTGGAGAGCTCACTCAT
Genomic location of T1181  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1818 marker 1818
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)